Coding regions of unigenes to protein sequences

Hi,

I have rna-seq data (unigenes) of four plant samples. I want to convert my nucleotide sequences into coding regions fasta file, and than, the same coding regions to protein sequences.

Any web server for that?

Thanks in advance,

Regards,

Waqas.

rna-seq sequencing sequence

• 1,662 views • link

written 10.7 years ago by waqasnayab

0 answers

No answers yet.

More posts like this

how can I predict the interface site of RNA with protein
written 7.2 years ago by bangbang3332 •

hi, I have a protein(PDB file) and an RNA sequence(5000bp, fasta file). I want to find the binding site in RNA sequence with the protein, …
Inversion validation / confirmation
written 8.0 years ago by waqasnayab

Hi, I am wondering how to validate / confirm the existence of inversion region in other WGS samples? For example, in one of my patient's …
Compare two columns of same file as paired rows
written 8.9 years ago by waqasnayab

Hi, Dear Community, I have a file like: CHR POS AACHANGE EFFECT chr1 11779914 R88W _ chr1 11779915 R88Q _ chr1 19694500 R478 H chr1 …
Blast unigenes with set of protein sequences
written 10.1 years ago by Kurban

Hello guys, I have more than 10,000 de novo assembled unigenes from RNA-seq, and blasted them against 95 protein sequences from another insect species get …
FASTA file of fixed length
written 10.3 years ago by waqasnayab

Hi, I have a FASTA file like this: >1 TCAAGAGGGGTGAATGTGTTTCGCATGCACAAGGGACAGGAGTCT >2 ATCAGAGCTGGTGGGGTGGAGAGACAGAAACAAGTGGGAGAAGGT >3 TTATACCTACCTTATAGATAAGGAAATTGAAGCTTATAGAGTTTA >4 ATTTTTCCTTATGATACTCTATTGCCTCTCCATGGATAAAGACAG >5 AAACTCCTGACCTCAGGTGATCCACCTGCCTCGGCCTCCCAAAGT >6 TGCACACCTTCAGAACTGTGAACCAAATAAACCTCTCTTCTTTAAAATTATTCATCCTCT GGTATTCCTTTATAACAA >7 CTCTTGATGTCATTTCACTTCGGATTCTTCTTTAGAAAACTTGGA Every sequence …
Extract only sequences that have N nucleotides
written 10.6 years ago by waqasnayab

Hi, I have a fasta file. From that fasta file, I need to extract only those sequences that have Ns nucleotides. ``` >seq1 AGCGGCGTAACGTCGTAGTC >seq2 …
Correlation between lncRNAs and mRNA from RNA seq data
written 10.8 years ago by hana

Hi I have 6 RNA seq samples (biological replicates). How can I find the co-expression protein coding genes with lncRNAs in my samples? Thanks in …
how to convert a protein sequence containing fasta file into DNA sequence containing file?
written 11.0 years ago by sansritisinha •

I have a protein file containing protein sequences, all homologs of each other from different species. I want to convert all the sequences into a …
How to annotate the nucleotide sequences in terms of KEGG Orthology (KO)?
written 11.3 years ago by bdpunith •

I have a RNA-Seq data in which I have to construct the KEGG Pathway for DGE between two samples. I also have nucleotide sequences (contigs) …
Translation Of Nucleotide To Amino Acid
written 13.8 years ago by figo

<p>HI All, </p> <p>I need to translate the multi fasta file nucleotide sequences to aminoacid into 6 reading frames and select the best reading frame …