More posts like this
-
Find strandness of sequences from raw sequences
written by ParhamHi, I have a tab delimited file that looks as follow: chr10 82148982 82149017 CAGAGACTGTCTACCCGGAATCAACTGA chr13 113829490 113829525 AAGAGGGACCTGACCCGGGGAGACCACC chr18 12376182 12376248 TTCCCGTGGCCGACCCGGGGACCTCAAC chr1 96371836 …
-
Need help : cut the fasta sequences from a specific region
written by Varshney •Hello everyone, I have a genome assembly file in the fasta format. I have to trim that sequences based on specific positions from that file. …
-
Identification of Contigs sequnce from cap3 output
written by Eva_MariaI did a cap3 alignment with set of Fasta sequences. From the cap3 results how can I identify what are the sequence contribute to make …
-
Gene variation study through blast tab limited out put
written by Eva_MariaI took a gene and aligned into 300 genome using Blast. From this Blast output (tab limited) how can I find gene variations(SNPs). Please help …
-
Extraction of best alignment in blast out put
written by Eva_MariaHey everyone I have about 4000 blast tab limited output, from thees output I want to extract best alignment (first line only) and want to …
-
How to assign taxonomy to trnL sequences using BLAST
written by gaddybergmann •<p>I am using the trnL chloroplast gene to identify plants from herbivore dung, and am currently trying to assign taxonomy to trnL sequences from my …
-
Blast sequence retrieval
written by Eva_MariaHi How to retrieve sequences from blast table format based on the e value?
-
How to calculate percentage identity/error rate from local alignment score?
written by crivensterHi, I have a local alignment on similar sequences using Smith-Waterman algorithm. I have alignment scores generated,how to calculate the percentage identity between the sequences? …
-
Blastn - Program Runs Indefinitely When Generating Xml Formatted Output
written by User 6228 •<p>I am running blastn on some nucleotide data, and it seems to run indefinitely when I generate XML output. The jobs take ~15 minutes when …
-
Convert Blast Output Into Blast-Xml
written by Fabsta<p>Hey!</p> <p>Problem: I need to convert a standard Blast report into the blastxml format.</p> <p>Background: For speed reasons, I am using UBlast (Usearch) instead of …
I think you need to elaborate on what you are trying to achieve in order to get some useful answers..
By using the appropriate subject identifiers. For a clearer response, please phrase your question better.
Hello akhilvbioinfo!
We believe that this post does not fit the main topic of this site.
Your post and comment history suggests you ask questions along similar lines yet do not provide details. Question closed until you elaborate on the topic. This might be of help: http://www.ploscompbiol.org/article/info:doi%2F10.1371%2Fjournal.pcbi.1002202
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!