Transcriptional regulation through transcription factor (protein) · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Transcriptional regulation through transcription factor (protein)

Hello everyone,

I have a list of transcription factors and their target genes, which I have downloaded from various online databases.I want to know that what kind of regulation exists between each TF-Gene pair, means weather it is upregulation, downregulation, coactivation etc.Is there any database or tool to find it? Please suggest.

Thanks

gene genome rna-seq

• 1,859 views • link

updated 4.0 years ago by Ram

• written 10.8 years ago by nivi1972 •

0 answers

No answers yet.

Log in to answer this question.

More posts like this

Heatmap / Gene List Similarity
written 3.1 years ago by cthangav •

I have a file with Transcription Factors (TF) and the predicted Target Genes (TG) they regulate, followed by the regulation score of the transcription factor …
Identify the potential TF involved in the regulation of DEGs
written 5.1 years ago by ryme •

Hi everyone, I have a list of differentially expressed genes from which I want to : 1. Identify the potential transcription factors involved in the …
finding consensus TF binding sites in a list of genes
written 6.9 years ago by Victoria •

Hi everyone, I am working on a transcription factor and performed RNA-Seq to find the possible targets for it. Now I want to know if …
Target genes of position-specific transcription factors
written 7.8 years ago by zaibunnisa.t •

I have a list of transcription factors with the following information: chrom position rs_ids cosmic_id motif_id motif_alt_id matched_sequence chr3 71435739 rs201008547 COSN16951339 MA0528.1 ZNF263 GAGGGAGGAAGGGACGGAGGG …
There any tools for gene regulation network visualizing?
written 8.4 years ago by Kurban

Hello guys, I have a set of transcription factors and their target genes (TF-TG connection), and their expression data from RNA-seq at a certain treatment …
transcrption factor analysis
written 9.3 years ago by flavia •

Hi, I want to do tf analysis using online tool kindly tell me how to do it: Steps of my work: 1)identification of degs using …
JASPAR motifs download
written 10.1 years ago by bharata1803

Hello, Currently, I want to make a list of Transcription factor-target gene pair. From this [ensembl regulatory database][1] I got the location of regulation region. …
is there any transcription factor and its target gene database?
written 11.4 years ago by Kurban

<p>hello everybody.<br /> is there any transcription factors and their target genes database.i have selected some transcription factors from my transcriptome data from an insect.now …
Tool Or Technique To Find Co-Occuring Motifs Within Genomic Intervals That Correspond To Tf Bindin…
written 12.9 years ago by ChIP

Hi! I have a list of transcription factors (along with their PWM) for which I want to check if they are co-occurring in my peaks …
Regulated Genes In A Pathway
written 13.0 years ago by sirinda111 •

<p>I want to get a list of regulated genes per pathway. The regulated genes are the target genes of transcription factors of a pathway and …