Try this 'simple' linux approach:

cut -d - -f1 old.fa > new.fa

It cuts your file into fields using '-' as the delimiter and then returns the first field.

You can replace first hyphen with space (I assume that sequence id and sequence are separated with space character).[?] You'll get file with three space-delimited fields, from which you can cut first and third.

sed 's/-/ /' your_file | cut -f1,3 -d" " > result

Provided that all of your header lines are of the form given in your question, the following sed should work:

sed 's/-[0-9]*-[0-9]*//g' myfile.fa > mynewfile.fa

That says: "replace hyphen, followed by digits, followed by hyphen, followed by digits, with nothing."

If you are using perl,

while(my $line=<INFILE>){
    chomp($line);
    next if(($line =~ m/^\#/) or (($line =~ m/^\"/))or ($line eq "")or ($line =~ /^\s*$/)); # skip comments, or empty lines

    #line = >LR24F01_Bbc10_2_15-53841001-53841229

    # Split the line on "-"
    my ($id, $start_coord, $end_coord) = split(/\-/,$line);

    # the result will be
    # id = LR24F01_Bbc10_2_15
    # start_coord = 53841001
    # end_coord = 53841229

    # to get sequence, split it on " " this time and get the second part
    my $sequence = <INFILE>;
    chomp $sequence;
    #sequence = atgcccgccccccgcgccgcccccccctctctcgct

    # now print them all together
    print "$id\n$sequence\n";
}

I wrote this in detail, so that you can understand each step. As you can see it can be done in one line command by Maciej, its good to understand how you can break the problem and apply it.

I hope this helps.

To complete the two sed-based examples, here is a pure Bash solution (based on pattern substitution):

while read l ; do echo "${l%%-*}" ; done < myfile.fa

Edit: Note that it doesn't apply to sequences with gaps.

If you're very sure that the hyphen appears only in the undesired part of the Id for all of the sequences, you can do a following perl split

while(<INPUTFILEHANDLE>){
      if(/^>/){
             my ($id, $unwanted)=split(/\-/,$_,2);
             print $id,"\n";
       }
      else{
             print $_,"\n";
       }
}