Fastx toolkits: fastq_quality_filter does not discart any read

Hello All,

I made a quality plot and now I would like to remove reads with a quality less than 25. I ran

fastq_quality_filter -q 35 -v -i U/Seqs/R1.fastq -o U/forward_filter_35

And I got:

Quality cut-off: 25
Minimum percentage: 0
Input: 11781134 reads.
Output: 11781134 reads.
discarded 0 (0%) low-quality reads.

I try with a higher filter (-q 35) and also I had 0 reads discarded. Do anybody know what is happening?

Thanks!

quality_filter fastx-toolkit

• 3,439 views • link

updated 3.9 years ago by Ram

• written 10.8 years ago by DVR •

Is this Phred 60? illumina encoding? or perhaps phred 33 (in which case add -Q 33 at the end of the command line)?

• 0 views • link

updated 3.9 years ago by Ram

• written 10.8 years ago by apelin20

1 answer

It's just -Q33 without space.

• 0 views • link

updated 3.9 years ago by Ram

• written 10.7 years ago by zorbax

More posts like this

Help with Tophat2 run
written 7.4 years ago by Neu •

Hi, I am getting the error as below when trying to run tophat2. Please help me to resolve this. command: tophat2 -o tophat_fusion --fusion-search --keep-fasta-order …
Need a piece of advice for microbiome data
written 9.4 years ago by unique379

Dear folks, I am new to analyze for micro biome data. I am trying to use mothur for my analysis. I have MiSeq paired (fastq) …
Raw Read Quality Filtering using FASTX-Toolkit of miRNA-Seq data
written 10.1 years ago by modihardikv •

I am analyzing miRNA-Seq data for differential expression analysis of miRNAs. First step in the process, I am performing is raw read quality filtering using …
How to save a terminal output in a txt file?
written 10.6 years ago by silas008

Hi, I am using Fastx Tool Kit and I need to save the output of command line. For example, if I use the `fastq_quality_filter` command, …
Analyzing Bisulfite Sequenced Reads
written 11.1 years ago by sm4bhat •

Hi, We have carried out targeted sequencing using ION TORRENT PGM of the PCR products amplified from bisulfite converted whole blood DNA. We have aligned …
Filtering sanger_fastq, illumina_fastq files using Fastx-Toolkit
written 11.3 years ago by bioinfo

I am doing some quality filtering of a large bunch of mixed fastq files produced from multiple versions of Illumina platforms. Thus, the quality scores …
What is appropriate coverage/quality filter for GATK for germline variants?
written 11.7 years ago by sviatoslav.kendall

I'm looking at germline variant profiles of cancer patients that have been processed using the GATK pipeline. My lab is looking for mutations that might …
Meaning of Base Alignment Quality (BAQ) 0
written 11.8 years ago by Andreas

Hi all, Every now and then I see BAQ values of 0 in samtools' mpileups. I thought I understood the overall concept (http://www.ncbi.nlm.nih.gov/pubmed/21320865), but now …
How to trim ngs sequences according to the phred score using python/biopython
written 12.3 years ago by linlinli99013 •

For fastq file, `.letter_annotations['phred_quality']` will give you the quality score of each base in your sequence. For example: ``` @M02339:45:000000000-A8L62:1:1101:14225:1785 1:N:0:5 GTTAGCACCCGATGTCTGTCTCCCGTGATTGCACTCTTCGGTATTCGGAGTTTGCTATGGCGGGGGAATCTGCAATAGACCCCCCAACCATGACAGGGCTCTACCCCCGAAGGGGAGACACGAGGCACTACCTAAATAG + CCCDCFFFCCCCGGGGGGGGGGHHGHGGHHHHHHHHHHHHGGHGHHHHGGGHHHHHHHHHHGGEG//EG3B44FG433FGHHGGGG/<A=?DDFGF///=/?11FGHG->-@D.@.-..:/.-:@@CF/0:FFFFG0;: ``` …
Bus Error From Fastx Toolkit'S Fastq_Quality_Filter
written 14.8 years ago by Behindtherabbit •

<p>I am trying to filter reads on sequence quality, using the command line version of fastq<em>quality</em>filter (fastx 0.0.13 for OS X 10.5.8; I am running …