This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Removing Adaptor From Illumina Pair-End Sequencing Data

I am confused about how to remove adaptor sequences from sequence reads during data preprocessing stage,
according to a post from seqanswer.com, PE adapters and primers are: PE Adapter1:

5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'

PE Adapter2:

5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

PE PCR Primer1:

5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3' 3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'

PE PCR Primer2:

5' -------------------- -------------------- ------------------ (-)-------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'

but, which sequence should i use?
currently, i use:

ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT
GATCGGAAGAGCGGTTCAG CAGGAATGCCGAG

as the adaptor sequence.

next-gen adaptor
• 4,437 views • link
updated by Damian Kao Damian Kao • written by Plantae Plantae

1 answer

[?]Illumina library adapter/primer sequences[?]

• 1 views • link
written by Damian Kao Damian Kao

Log in to answer this question.

More posts like this