This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Assemble short reads based on k-mers

Hello all,

I am completely new for this kind of tasks. I have data like this,

>in0
GATCCTCGAAGTTACACGGG
>in1
TACGTCGACGTCAATCCGGG
>in2
TACACGGGCCGCTCCTGGGC
>in3
ACGGGGTACTACGAGACGCG
>in4
AGGGGGAATGTGGTCCACAT
>in5
TCCACATGGCTTGCTCCTGA
>in6
CTTGACGTTATGAATTTCGC

and so on..I need to assemble these short reads. I want to use perl for this. I just need a pseudo code on how to do this or direct me to a good resource. At the end I need a single string containing consensus sequence.

perl k-mer assembly
• 4,507 views • link
updated by Ram Ram • written by venu venu

Is their a reason you want to reinvent the assembly wheel? There are a good number of assemblers already written, why bother writing yet another one without a good reason?

• 0 views • link
written by Devon Ryan Devon Ryan

Can you give me some examples, so that I can find them directly on the internet.

• 0 views • link
written by venu venu

As orange said, SOAPdenovo is one option. Others would include Trinity and Minia. There are quite a few of these if you just search pubmed for "DNA assembler" or "DNA assemble".

• 0 views • link
written by Devon Ryan Devon Ryan

3 answers

why not try SOAPdenovo instead of perl ? Did you not aseembly genome sequence before ?

• 0 views • link
written by orange • orange

Assuming you want to stick to Perl for educational purpose:

Here is some code to quite efficiently create kmers with Perl: https://github.com/thackl/perl5lib-Kmer/blob/master/lib/Kmer.pm.

Perl is not really made for handling graph structures, but there is one module that you could use to set up a De-Bruijn structure: http://search.cpan.org/~jhi/Graph-0.96/lib/Graph.pod. I played around with it some time ago but did not follow through.

• 0 views • link
written by thackl thackl

I just need a single string of consensus sequence from the above shown file

• 0 views • link
written by venu venu

But definitely in Perl?

• 0 views • link
written by thackl thackl

Not exactly, but any simple program that receives the above file as input and outputs the consensus string. I can understand the perl code easily, so the tag.

• 0 views • link
written by venu venu

But your data sets are small - you want to do some form of microassembly?

• 0 views • link
written by thackl thackl

Yes. I've 200 such reads in a file and I want an output like

 GGCATTTAACCGAAGCCGGTGGGTTAGACTATGATCCTCGAAGTTACACGGGCCGCTCCTGGGCGTGGCTGCTCCCAGCCCTAGCCCCAATGTAATATAAAGGTCGTGCCCAGTTAGCGTTAAGCAAGAGGTGTTACAAATATCTTGGAGAGTCATGTCGCAATTCTTGACGTTATGAATTTCGCGGTGAACAATGTCGCCCAGAATGGCAGGTCATGAAAAGCTTCAGCGGGAACCAGCAC....
• 0 views • link
written by venu venu

What is the coverage of the reads and the length?

• 0 views • link
written by thackl thackl

I am doing this kind of work for the first time. What I know is each read has different lengths of k-mers.

• 0 views • link
updated by Ram Ram • written by venu venu

You can use SPAdes:

spades.py --only-assembler --sc -k 33 -s in.fq -out asm
  # results are in asm/contigs.fa

This should also work for lowish coverage (5-10X) but assumes little to no errors in your data. Also, there can be multiple contigs and regions with very low coverage (just a 1-3 reads at a certain position, e.g. the ends of you target sequence) will be missing.

• 0 views • link
updated by Ram Ram • written by thackl thackl

Log in to answer this question.

More posts like this