Hello!
Who can help me with a writing a script?
1. For each file in the set (archive, probably):
Open input nucleotide sequence (.embl format is desirable, but fasta format is possible);
Calculate the observable frequency for all possible words based on input word size (e.g. number of all possible words for word size = 3 (triplet) is 64). Obs. Frequency = Obs Count/Total count [Сompseq is work in a similar way, but not support a batch processing].
Shift the reading frame by 1 nucleotide and repeat the previous step (number of shifts = word size - 1). The file with frequencies for each file in the set save as name_of_the_file(id of a contig).dic(+word size). It looks something like this (word size = 2):
# Word Obs Count Obs Frequency
AA 194 0.0757221
AC 129 0.0503513
AG 203 0.0792350
AT 185 0.0722092
CA 212 0.0827479
CC 174 0.0679157
CG 49 0.0191257
CT 174 0.0679157
GA 175 0.0683060
GC 142 0.0554254
GG 131 0.0511319
GT 118 0.0460578
TA 130 0.0507416
TC 163 0.0636222
TG 184 0.0718189
TT 199 0.0776737
2. Make a summary file, something like this (example for word size = 2)
AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT
comp730_c0_seq1 description 0,019133 0,015228 0,019914 0,021476 0,019914 0,011324 0,003124 0,016009 0,025381 0,019524 0,017571 0,01679 0,015228 0,0164 0,016009 0,0246
comp741_c0_seq1 description 0,016957 0,012832 0,010541 0,016957 0,008708 0,012832 0,009166 0,01604 0,015124 0,010541 0,0055 0,010082 0,01604 0,028414 0,010999 0,021998
comp752_c0_seq1 description 0,025503 0,012081 0,02953 0,022371 0,010738 0,009843 0,009396 0,008054 0,026846 0,024161 0,021477 0,012528 0,012081 0,021029 0,019687 0,018792
comp767_c0_seq1 description 0,030486 0,016032 0,028384 0,016557 0,021288 0,010775 0,007096 0,009461 0,028121 0,016557 0,021025 0,017608 0,011301 0,01866 0,02339 0,020237
comp773_c0_seq1 description 0,044055 0,017054 0,023685 0,026528 0,014685 0,020369 0,010422 0,008053 0,026528 0,01658 0,016106 0,014211 0,024633 0,01658 0,016106 0,020369
..
..
..
..
..
..
•
written
by
thom_otis •
0 answers
No answers yet.
Log in to answer this question.
-
problem with HOMER findMotifsGenome.pl
written by ste.lu
-
findGenomeMotif.pl in Homer couldn't work properly
written by xuenjun1 •
-
Writing a csv file python
written by elisheva
If a word (say, AAAAACCCCCTTTTTGGGGG) doesn't exist, but you're looking at 10bp words, do you want the count to be 0, or do you just not want it to show up in the final list?
I think, it's necessary to show the words that have a frequency of zero.
This is not a bioinformatics question.This is a niche string manipulation question that uses sequence data. I'm not sure if this belongs here.
Hello thom_otis!
We believe that this post does not fit the main topic of this site.
Looks like homework to me.
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!