This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Alignment Software That Considers Fastq Quality

We know that the Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. But it seems that it doesn't have quality of fastq. So what is the best software to deal with it?

I want to compare two sequence with fastq quality such as

GCCTACAGAATCTAGAAAATAgcctcaaaaggacaaatctaagtggtattggccttaaag
aggaggtggggagtgtagaaagtgtattcaaagggatagtaacagaacgtcccaaaccta
cagaaagatatcaatatccaagtacaagaaagttataaaacaccgagcagatgtaactca
aagaagactacctcaaggaatttaataatcacagtcccaaagatcaaggataaagaaagg
atcttaaaagcagcaagagaaaagaaaccaataatatacaatggagctacaatatatctg

And

ACCATGCTGTTTTGGATACTGTAGCCTTATAGTTTGAAGCCTCTGGCTTTGCCCTTTTGC
TTAGATTTGCTTAGGCTGTTGAGGCCCTCTTTTGGTTTCATATGACTTCTagaatacttt
tttctaattctgtgaagaacgaCATTGGTAGTTTGATAGAAATAGCACTGAATCTGTCAA
TTGCTTTGGGCAGTGTGGCCATTTGAATGATACtgattcttccaatccatgagcatggaa
tgtttttccatttaattgtgttatctctgatttctttccgcagtgttttatagttcttgt

Not sure if it is a proper question.

Thanks.

alignment quality fastq
• 3,890 views • link
updated by Jeremy Leipzig Jeremy Leipzig • written by Love • Love

I don't understand how quality is being represented here - are you trying to depict quality as lowercase or blue or are you interested in using a true fastq file format?

• 0 views • link
written by Casey Bergman Casey Bergman

I am just interested in using a true fastq format. I am not sure why the blue was printed after I copyied and pasted strings.

• 0 views • link
written by Love • Love

1 answer

Most people just trim, but there is something to be said for quality scaling. Ketil Malde's paper "The effect of sequence quality on sequence alignment" discusses this.

http://bioinformatics.oxfordjournals.org/content/24/7/897.short

The pairwise alignment tool in Biostrings has some facilities to deal with this as well.

• 1 views • link
written by Jeremy Leipzig Jeremy Leipzig

How to trim it? Do you mean to use "FASTX" toolkit?

• 0 views • link
written by Love • Love

yes either fastx or sickle or using a bio* project

• 0 views • link
written by Jeremy Leipzig Jeremy Leipzig

I am going to use fastx, so which command should I use? FASTQ Quality Filter? or FASTA/Q Trimmer? There are many "n" in the sequence, should I discard it?

• 0 views • link
written by Love • Love

Log in to answer this question.

More posts like this