This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RSAT: matrix scan result interpretation

Hi everyone,

I am trying to predict putative transcription factor binding site(TFBS) using RSAT tools based on position weight matrix. in that process I came across results like presented below. please help me interpreting the results.

Training set sequence: TGGGTCCCACAT (experimentally validated TFBS)

Input data: TAAAGCTTCCTTAAAAGTCTCCTCTTTCCCCCCCCGTTTCCACCTCTCTT

strand   start   end   sequence       weight   Pval       ln_Pval   sig
R        -27     -16   GGGGGGGGAAAG   21.5     1.10E-11   -25.257   10.969
R        -26     -15   CGGGGGGGGAAA   21.1     1.70E-11   -24.783   10.763
R        -25     -14   ACGGGGGGGGAA   20.8     2.30E-11   -24.494   10.638
R        -28     -17   GGGGGGGAAAGA   20.5     3.10E-11   -24.19    10.506
rsat

0 answers

No answers yet.

Log in to answer this question.