Biostar Beta. Not for public use.
RSAT: matrix scan result interpretation
0
Entering edit mode
4.2 years ago
dinesh • 50
India

hi every one, i am trying to predict putative transcription factor binding site(TFBS) using RSAT tools based on position weight matrix. in that process i came across results like presented below. please help me interpreting the results.

training set sequence: TGGGTCCCACAT (experimentally validated TFBS)

input data: TAAAGCTTCCTTAAAAGTCTCCTCTTTCCCCCCCCGTTTCCACCTCTCTT


strand start end sequence weight Pval ln_Pval sig
R -27 -16 GGGGGGGGAAAG 21.5 1.10E-11 -25.257 10.969
R -26 -15 CGGGGGGGGAAA 21.1 1.70E-11 -24.783 10.763
R -25 -14 ACGGGGGGGGAA 20.8 2.30E-11 -24.494 10.638
R -28 -17 GGGGGGGAAAGA 20.5 3.10E-11 -24.19 10.506
ADD COMMENTlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.3.1