This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Convert annovar file to vcf file

Hi,

I have a annovar file for the High Confidence Indels which looks like this:

#Chr    Start       Ref                                          Obs
1       1588536     -                                            TAA
1       1588745     GCG                                          -
1       1651078     -                                            TCGCTCTGTCACCCAGGCT
1       2184046     C                                            -
1       2615857     CTGGAACACCACCCTGCACCCCCAGGTGAGCATCTGACGGC    -
1       8087069     -                                            TA
1       8337360     -                                            CTCA
1       10357207    T                                            -
1       14109409    TT                                           -
1       17631815    -                                            A

Since, annovar uses "-" for Insertion or Deletion, I can not use this file directly to compare with vcf files.

Can anyone tell me how I can convert this annovar file to vcf file (with reference to hg19).

Thanks

Amit Goyal

next-gen assembly
• 5,401 views • link
updated by Ram Ram • written by amitgsir amitgsir

1 answer

I got an answer for Kai Wang. I hope it can help others too.

Hi Amit,

You will need to convert this to VCF yourself, by padding the nucleotide that corresponds to "-". This can be done by retrieve_seq_from_fasta.pl (specifying chr:start-end).

But you can certainly compare this file to VCF directly. Just use -vcf as dbtype option in -filter operation.

-Kai

• 0 views • link
updated by Ram Ram • written by amitgsir amitgsir

Hi Amit,

Would you please list the steps on how you went about the retrieving the bases for '-'

Many thanks, Faraz.

• 0 views • link
written by faraz.k89 • faraz.k89

Log in to answer this question.

More posts like this

No similar posts found.