When I use glimmer3.02 to predict orf, there is an error occurred.

The script I used is g3-iterated.csh.

The error is:

Step 5 of 8:  Getting training coordinates
Step 6 of 8:  Making PWM from upstream regions
Segmentation fault (core dumped)
Error parsing file 'out.glimmer.upstream'. Not a Fasta file?
Failed to create PWM

I have checked the .upstream file, and I found something wrong with this file:

$ tail out.glimmer.upstream
CGTAAGTCATTGCCCCACCGCCCCA
>orf00020  24139 24115  len=25
CAAACAGATCAGCCAACTGAAGATT
>orf00021  25615 25591  len=25
TCTCCAAGGCGAATGAGGGCGCTCT
>orf00022  26092 26116  len=25
CATTCCAGAAAAGCCCTGCTGGTAG
>orf00023  27902 27926  len=25
CTTCTATATATAGAAGAAACACTTT
>orf00024  30945 30921  len

Obviously, the file has not gone to the end.

I don't know what was wrong here, please help me, thank you!

ps. I can run the sample in the glimmer normally, and the difference between my file and the sample I can find is my Fasta file is a multi-fasta file which has 10 sequences in the file.