glimmer: Error parsing .upstream file. "Not a Fasta file?"
When I use glimmer3.02 to predict orf, there is an error occurred.
The script I used is g3-iterated.csh.
The error is:
Step 5 of 8: Getting training coordinates
Step 6 of 8: Making PWM from upstream regions
Segmentation fault (core dumped)
Error parsing file 'out.glimmer.upstream'. Not a Fasta file?
Failed to create PWM
I have checked the .upstream file, and I found something wrong with this file:
$ tail out.glimmer.upstream
CGTAAGTCATTGCCCCACCGCCCCA
>orf00020 24139 24115 len=25
CAAACAGATCAGCCAACTGAAGATT
>orf00021 25615 25591 len=25
TCTCCAAGGCGAATGAGGGCGCTCT
>orf00022 26092 26116 len=25
CATTCCAGAAAAGCCCTGCTGGTAG
>orf00023 27902 27926 len=25
CTTCTATATATAGAAGAAACACTTT
>orf00024 30945 30921 len
Obviously, the file has not gone to the end.
I don't know what was wrong here, please help me, thank you!
ps. I can run the sample in the glimmer normally, and the difference between my file and the sample I can find is my Fasta file is a multi-fasta file which has 10 sequences in the file.
• 2,596 views
•
link
0 answers
No answers yet.
Log in to answer this question.