This is a test version of Biostars. For the public version, visit https://www.biostars.org.
BS-sequencing, quality control

I have paired-end bisulfite sequencing reads. This is the quality plot:

< image not found >

As you see, a lot of bases have low quality. However, these low-quality bases follow the following pattern:

TAATTTGNNCGTCTGCTGTTTTTTTTGGATGTGGTAGTTGTTTTTCAGGTTTTTTCTTCGGAATCGAATTCTAATTTTTCGTTATTCGTTATTATTATGGT
+
AAAAAFF##FAF<FFFAFF7FF.FAFFFFFFFFFF.FFFFFAF<FFFFFFFFFFFFFFFAF<.FA.FFAAAAFFFFFFFFAFFFFFAAFAAFF<AF<FFFF

Low quality bases around high quality bases. Is this normal?

sequencing

1 answer

No, this isn't normal, even with BS-seq datasets where base qualities tend to be a bit lower. I've just looked at a couple of mine and they don't show anything like that. Having said that, I wouldn't worry that much about this. It's likely that your alignment efficiency will be a bit lower, but this is probably still a salvageable dataset. When you get to the methylation extraction step of your pipeline, be sure to use an extractor that can filter according to base phred quality. If whatever you normally use doesn't support this, then just use PileOMeth.

Edit: BTW, are these Illumina reads? I assume so but it's good to double check. I expect ion torrent among others has a different error profile and might have issues with datasets like this.

Yes, they are Illumina reads. So, you would proceed by aligning these reads, right? I might get rid these bases by considering quality of sliding windows, but I lose more than 30% of all reads...

Yeah, I'd go ahead and align them. Do trim adapters, but don't go crazy with the quality trimming. Have a look at the resulting alignments and try to gauge if they're too screwy due to the weird base quality. If they're not, just exclude those bases during methylation extraction. If they are, then you probably need to trim aggressively, but that should be a last resort.

Log in to answer this question.