This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Circularizing and trimming with toAmos and minimus2

Dear all,

I am trying to follow the Circularizing and trimming described here for pacbio assembly.

I have tried many times but I could not get the result circularized.fasta from the overlapping step and joining step from minimus2. I tried a test.fasta by putting a break in the middle after making a reverse of my contig:

>contig
ACGTCTACTACTACGTAGCTACTACTGTGAATCTAGGACTACTAGCTAGCTATCGTACTATCGATCTCTACTGCG
>break
GCGTCATCTCTAGCTATCATGCTATCGATCGATCATCAGGATCTAAGTGTCATCATCGATGCATCATCATCTGCA
amos-3.1.0/bin/toAmos -s rev.fasta -o circularized.afg
amos-3.1.0/bin/minimus2 circularized

I get all these files

circularized.bnk circularized.fasta circularized.qry.seq
circularized.singletons.seq circularized.contig
circularizedls.runAmos.log circularized.ref.seq
BioPerl-1.6.1 circularized.coords circularized.ovl
circularized.runAmos.log
circularized.afg circularized.delta circularized.OVL
circularized.singletons

When I am checking the circularized.fasta,it is empty and I do not have any error in my log, all the contigs are here

circularized.singletons.seq
cat circularized.singletons.seq
>contig
ACGTCTACTACTACGTAGCTACTACTGTGAATCTAGGACTACTAGCTAGCTATCGTACTATCGATCTCTA
CTGCG
>break
GCGTCATCTCTAGCTATCATGCTATCGATCGATCATCAGGATCTAAGTGTCATCATCGATGCATCATCAT
CTGCA
pacbio-assembly trimming minimus2 circulizing amos

Rest of the message

cat circularized.runAmos.log


!!! 2015-03-17 17:56:38 Started by root@... on Tue Mar
17 17:56:38 2015

!!! 2015-03-17 17:56:38 Doing step 10: Building AMOS bank & Dumping reads
!!! 2015-03-17 17:56:38 Running: rm -fr circularized.bnk
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 11
!!! 2015-03-17 17:56:38 Running: /root/amos-3.1.0/bin/bank-transact -c -z
-b circularized.bnk -m circularized.afg
START DATE: Tue Mar 17 17:56:38 2015
Bank is: circularized.bnk
0% 100%
AFG ..................................................
Messages read: 6
Objects added: 6
Objects deleted: 0
Objects replaced: 0
END DATE: Tue Mar 17 17:56:38 2015
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 12
!!! 2015-03-17 17:56:38 Running: /root/amos-3.1.0/bin/dumpreads
circularized.bnk -M 0 > circularized.ref.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 13
!!! 2015-03-17 17:56:38 Running: /root/amos-3.1.0/bin/dumpreads
circularized.bnk -m 0 > circularized.qry.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 20: Getting overlaps
!!! 2015-03-17 17:56:38 Running: /root/MUMmer3.23/nucmer -maxmatch -c 40
circularized.ref.seq circularized.qry.seq -p circularized
1: PREPARING DATA
2,3: RUNNING mummer AND CREATING CLUSTERS
# reading input file "circularized.ntref" of length 152
# construct suffix tree for sequence of length 152
# (maximum reference length is 536870908)
# (maximum query length is 4294967295)
# CONSTRUCTIONTIME /root/MUMmer3.23/mummer circularized.ntref 0.00
# reading input file "/root/circularized.qry.seq" of length 151
# matching query-file "/root/circularized.qry.seq"
# against subject-file "circularized.ntref"
# COMPLETETIME /root/MUMmer3.23/mummer circularized.ntref 0.00
# SPACE /root/MUMmer3.23/mummer circularized.ntref 0.00
4: FINISHING DATA
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 1s

!!! 2015-03-17 17:56:39 Doing step 21
!!! 2015-03-17 17:56:39 Running: /root/MUMmer3.23/show-coords -H -c -l -o
-r -I 94 circularized.delta | /root/amos-3.1.0/bin/nucmerAnnotate | egrep
'BEGIN|END|CONTAIN|IDENTITY' > circularized.coords
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 22
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/nucmer2ovl -ignore
20 -tab circularized.coords | /root/amos-3.1.0/bin/sort2 > circularized.ovl
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 23: Converting overlaps
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/ovl2OVL
circularized.ovl > circularized.OVL
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 24: Loading overlaps to the bank
!!! 2015-03-17 17:56:39 Running: rm -f circularized.bnk/OVL.*
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 25
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/bank-transact -z -b
circularized.bnk -m circularized.OVL
START DATE: Tue Mar 17 17:56:39 2015
Bank is: circularized.bnk
0% 100%
AFG
Messages read: 0
Objects added: 0
Objects deleted: 0
Objects replaced: 0
END DATE: Tue Mar 17 17:56:39 2015
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 30: Running contigger
!!! 2015-03-17 17:56:39 Running: rm -f circularized.bnk/LAY.*
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 31
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/tigger -b
circularized.bnk
Pulling reads from bank circularized.bnk
Pulled 2 reads from bank
AMOS Overlap Bank circularized.bnk does not exist
total contained reads hidden 0
number of contigs 2
total contained reads unhidden 0
Writing layouts to bank circularized.bnk
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 40: Running consensus
!!! 2015-03-17 17:56:39 Running: rm -f circularized.bnk/CTG.*
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 41
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/make-consensus -B -e
0.06 -b circularized.bnk -w 15
Starting on Tue Mar 17 17:56:39 2015

Read bank is circularized.bnk
Alignment error rate is 0.06
Minimum overlap bases is 5
Output will be written to the bank
Input is being read from the bank
Processed 0 layouts
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 50: Outputting contigs
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/bank2contig
circularized.bnk > circularized.contig
Processing circularized.bnk at Tue Mar 17 17:56:39 2015
End: Tue Mar 17 17:56:39 2015
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 60: Converting to FastA file
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/bank2fasta -b
circularized.bnk > circularized.fasta
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 70: Getting singletons
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/listReadPlacedStatus
-S -E circularized.bnk > circularized.singletons
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 71
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/dumpreads -e -E
circularized.singletons circularized.bnk > circularized.singletons.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! END - Elapsed time: 0d 0h 0m 1s

Any idea?

Thanks in advance

I also have same problem . Did you manage it ??

Hello,

No I could not, but I saw that at the step 21 my *.ovl file is empty, have you the same problem?

Best

I checked at step 21 my *.ovl file is empty,if someone gets the same problem?

Hello, I also have the same problem with the *.ovl file empty, does any one find a solution

Regards

0 answers

No answers yet.

Log in to answer this question.