This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Tool: DiscoSnp becomes DiscoSnp++

DiscoSnp major update: DiscoSnp becomes DiscoSnp++

Major modifications were made on DiscoSnp these last few weeks. Improvements are the following:

  • Thanks to the recoding using the GATB library:
    • An even quicker execution speed, and the parallelization of the kissnp2 module.
    • An improved progression message
    • A unique file for storing the graph. This file (.h5) may be used in any GATB tool.
  • DiscoSnp is no more limited to isolated SNP detection:
    • Up to P (parameter) close SNPs may be found within a unique bubble
    • Insertions and deletions of length lower or equal to D (parameter) are also detected.

Regarding these modifications, and as DiscoSnp is not limited only to SNP prediction anymore, we decided to change also its name.

Thus DiscoSnp becomes DiscoSnp++. The first release version is DiscoSNP++-2.0.0.

Original DiscoSnp paper: Reference-free detection of isolated SNPs

Official DiscoSnp++ page: http://colibread.inria.fr/software/discosnp/

Comments and feedback are welcome.

indels discosnp gatb snp

2 answers

Hello Paolo,

Thanks for your message.

We don't have much hindsight with these kind of datasets. We are currently investigating the application of discoSnp on RAD seq data (take care of heterogeneous coverage), but we cannot assess yet precisely the results quality.

We have never conducted any experiments nor had any feedback on applying discoSnp on GBS (I'd be curious to know results).

Pierre

Hi Pierre,

I'm new of SNPs discovery pipelines and I'm in the need to use a free-reference tool to obtain SNPs from a non-model species. I wonder if DiscoSNP can be able to handle GBS or RAD data to obtain a set of new SNPs loci.

Many thanks!

Paolo

Hi Pierre,

Thanks a lot to have provided me a reply about my previous inquiry! Maybe, I could try to run DiscoSNP with my current dataset but I read the User Guide and I'm not sure it will work well......but if there will be something of interesting I'll let you know! In any case, I hope to find new updates for RAD tags on DiscoSNP, soon, it would be quite adequate for my current data.

Thanks a lot again!!

Cheers!

Paolo

Hi Pierre,

DISCOSNP++ seems to be exactly what I am looking for to call SNPs in microsatellite flanking regions for a coral species. However it doesn't seem to detect any SNPs even though I can visually seem them. I am wondering if the sequences are too short? I am inputing a fasta file with sequences at a single loci to test: Here is a short example fof_test.txt:

data_test/align_P1.fasta

>S10_C10_1_a1
ATGTGAGAAAGCTAATCCATTTTTAAT
>S10_C12_1_a1
ATGTGAGAAAGCTAATCCATTTTTAAT
>S9_C8_1_a1
ATGTGAGAAAGCTAATCCATTTTTAAT
>S9_C9_1_a2
ATGTGAGAAAGCTAATCCATTTTTAAT
>S10_C18_1_a1
ATAATCCATTTTTAAT
>S10_C19_1_a1
ATAATCCATTTTTAAT
>S7_C13_1_a1
ACGTGAGAAAGCTAATCCATTCTAAT
>S7_C14_1_a2
ACGTGAGAAAGCTAATCCATTCTAAT
>S11_C21_1_a3
ATGTGAGAAAGCTAATCCATTTTTAAC

However I don't get a result file and the results on the terminal show empty bubbles. Any idea of what I could be doing wrong?

Thank you, Annick

Hi Annick,

Thanks for your message and your patience :)

disco finds variants surrounded by at least k nucleotides left and right. By default, k=31 explaining why disco does not find results on your example.

Pierre

Log in to answer this question.