This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Aligning several sequences with EMBOSS water program

Hello

I am trying to use EMBOSS water program to align several sequences stored in one fasta file to a sequence in another file. I'm NOT taking about multiple sequence alignment, I just want to align each sequence in the first file to the single sequence in the second file.

my first file looks like that:

>cel-let-7-3p MIMAT0015091 Caenorhabditis elegans let-7-3p
CUAUGCAAUUUUCUACCUUACC
>cel-lin-4-5p MIMAT0000002 Caenorhabditis elegans lin-4-5p
UCCCUGAGACCUCAAGUGUGA
>cel-lin-4-3p MIMAT0015092 Caenorhabditis elegans lin-4-3p
ACACCUGGGCUCUCCGGGUACC

Water's documentation states that 'water reads a nucleotide or protein sequence and one or more sequence to be aligned to it. ' So I suppose what I want to do should be possible.

However, when I Insert the sequences to water, only the first sequence is aligned. I tried this with different sequences occupying the first position in the file so I know it's not because there are no alignments for the other sequences. Water just seems to ignore them.

I know this is possibly a stupid question, but I have no idea how to solve this and would appreciate your help

Thanks in advance

Dolev Rahat

alignment emboss

do you want to create a number of pairwise alignments or a single multiple sequence alignment?

OP wants to have a bunch of pairwise alignments with each member of the query set {A..Z} being aligned to a single subject.

1 answer

From the documentation online, it's clear that EMBOSS water aligns two sequences using the Smith Waterman algorithm. Your approach should be:

  1. Save the single sequence that you wanna compare all queries to in a file called "single_seq.fa" in the current working directory
  2. Split each query into a separate file, put them all into a sub-directory "queries" in the current working directory
  3. For each query_file in the directory ./queries, run emboss water aligning the query_file to the single_seq.fa file (you'll need stand-alone EMBOSS, not the web version for this)

I thought I might be able to avoid running multiple sessions of water. But coming to think of it it's not such a big deal anyways. Thank you for your answer

You're most welcome. Standalone versions of tools exist so they can solve a problem in its atomic form and give you the power to fashion your own solution with the lego blocks they offer. Seldom are solutions we need tailored to our exact requirements :(

Log in to answer this question.