This is a test version of Biostars. For the public version, visit https://www.biostars.org.
I tried to visualize the bam file in IGV or genome viewer

hello guys

please someone help me again

i have indexed sorted.bam file and want to visualize it in IGV or genome viewer in windows

i launched or downloaded bamview but it says application cant be launched, my java is 32

what can i do to visualization????

next-gen

What specific error message is it giving you?

Alternatively, you can upload it to Galaxy and view it there.

Hello Dan

What I exactly want to do is indexed sorted.bam file visualization by IGV or genome browser.

I did these steps: I downloaded IGV and produced indexed sorted.bam file. For visualization, whether I need to use BamView or I can upload my file directly to IGV? I downloaded BamView but when launching it said: application cant be launched

IGV wants your indexed BAM file. You mentioned that IGV wouldn't launch. It should have given you a specific error message. If you can tell me what that message said, I may be able to help you start IGV on your machine. Sometimes IGV needs some love before it will run properly.

Thank you Dan - at last I launched bamview

Hello Dan

I have two fastq files, first set are the footprints, while the second sets are data coming from a common RNA-seq experiment performed in parallel, I want to adapter sequences, using the software CUTADAPT

The adapter sequences are:

GTTCAGAGTTCTACAGTCCGACGATC # 5 prime adapter sequence
ATCTCGTATGCCGTCTTCTGCTTG # 3 prime adapter sequence

May you please tell whether and how I can do this project with windows seven 64 bit?

Help me please

Thank you

1 answer

Download IGV. index your bam file and reference genome. Load reference genome first ( genome --> load geome). Then load bam file (file --> load file). Go to the chromosome of your interest and zoom.

If your computer does not have good configuration, get subset of reads from bam file (may be chromosome wise) and load them.

thank you so much i will pursue your tips

Log in to answer this question.