mirdeep2: miRDeep.pl error
I wonder if somebody knows how many different (not concatenated) samples can be analyzed with miRDeep.pl module of mirdeep2 package. I have some troubles to analyze more than 2 samples. After preparing reads_collapsed.fa (-m option to collapse reads applied) e reads_vs_genome.arf applying config-file e mapper.pl module for 12 samples, I've got an error running miRDeep.pl: repeated sequencies in the reads_collapsed.fa.
=========
The sequence
TGTAAACATCCTCGACTGGA
occures at least twice in sample XXX in your reads file
=========
Why does it happen? Did the collapsing failed?
• 2,747 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Have you solved this problem?