This is a test version of Biostars. For the public version, visit https://www.biostars.org.
eprimer3 and primer3 incompatible still?

I am using the most up to date version of emboss (6.6.0) and primer3 (2.3.6), yet I STILL cannot get them to run correctly. I've searched around for a lot of help on this and have followed many of the recommendations, but nothing works. Currently when I run eprimer32 I get a seg fault which I think is coming from primer3? And when I run eprimer3 I get the SEQUENCE_TAG error. Are there any additional recommendations that you may have that I have not been able to find online?

Things I have tried:

  • using eprimer32 instead with the copied version of primer32_core
  • set the EMBOSS_PRIMER3_CORE variable
  • use current option names
  • calling eprimer3 from command line and also from BioPython Primer3CommandLine
  • I've seen this too eprimer3 and primer3 compatibility problem and it lead me to no answers.

This is the command (attached is my input seq):

eprimer32 -outfile=./eprimer_out \
  -sequence=./eprimer_in_seq \
  -task=2 \
  -includedregion=1,40 \
  -optsize=35 \
  -minsize=35 \
  -maxsize=35 \
  -opttm=65 \
  -mintm=40 \
  -maxtm=100 \
  -maxdifftm=100 \
  -mingc=10 \
  -maxgc=90 \
  -prange=40,200

My input file:

GCCCCTTTGAAATGATGGTGTCAGAGTGCAGAGAAACAATGGAGTTTTGATGCCAAAAAGGTTTTTTTGCAGTAAAAGTAAAAATTTGGAATTAGTTGGCATATAGAGGAACCCTTTTGTACTGGAACGTATGAGGCTGGATTGTGAAAAGGTAATCTTTCGATTGCTAGACTTGGTTAACTTAGGGCTGCAAATCTTTTTCTTCTGTCAAGGTCACTTAATATGGAATGTTTTTGTCAGA
eprimer3

I am getting seg fault as well. Reported this as a bug to emboss and I will try to update this thread with a link when it is available.

1 answer

I was also having this problem. I remember this problem when it first popped up 5 years ago or so, and so I am in disbelief to be dealing with this 5 years later on a fresh install of "emboss" package on a new Ubuntu 14.04 box. I assume the fault is with the package maintainers, and not EMBOSS.

A (partial) solution is to use eprimer32 and also set the env var EMBOSS_PRIMER32_CORE. Following shows two ways that don't work, and the third example is working. The reason I say it is "partial" is that I am not sure this solution will work for those trying to access Primer3 via Bio.Emboss.Applications.Primer3Commandline

Non-working example 1

$ eprimer3 -sequence gapdh.fasta -stdout                                                                     
Pick PCR primers and hybridization oligos
Whitehead primer3_core program output file [stdout]: 
Error: Missing SEQUENCE tag
# EPRIMER3 RESULTS FOR 6534405-6538375
#                      Start  Len   Tm     GC%   Sequence

Non-working example 2

$ eprimer32 -sequence gapdh.fasta -stdout                                                                    
Pick PCR primers and hybridization oligos
Died: eprimer32 uses external program 'primer32_core' which is not in the PATH or defined as EMBOSS_PRIMER32_CORE
     Part of the 'primer3' package, version 2.2.3, available from the
     Whitehead Institute. See: http://primer3.sourceforge.net/ The
     primer3_core application must be renamed to primer32_core

Working example 3

$ EMBOSS_PRIMER32_CORE=/usr/bin/primer3_core eprimer32 -sequence gapdh.fasta -stdout                       
Pick PCR primers and hybridization oligos
Whitehead primer3_core program output file [stdout]: 
# EPRIMER32 RESULTS FOR 6534405-6538375
#                      Start  Len   Tm     GC%   Sequence
   1 PRODUCT SIZE: 199
     FORWARD PRIMER    2248   20  59.82  60.00  CAGCCCCTTCATACCCTCAC
     REVERSE PRIMER    2427   20  60.03  55.00  AGCCACACCATCCTAGTTGC
   2 PRODUCT SIZE: 199
     FORWARD PRIMER    3469   20  60.18  60.00  GCATCCTGGGCTACACTGAG
     REVERSE PRIMER    3648   20  60.11  50.00  TTTTTCTGAGCCAGCCACCA
   3 PRODUCT SIZE: 204
     FORWARD PRIMER    1371   20  60.11  60.00  GGAAACCAGATCTCCCACCG
     REVERSE PRIMER    1555   20  59.96  60.00  TTAACCCCCTAGTCCCAGGG
   4 PRODUCT SIZE: 194
     FORWARD PRIMER    3007   20  60.04  60.00  GACTGAGGCTCCCACCTTTC
     REVERSE PRIMER    3181   20  60.03  55.00  AGTGATGGCATGGACTGTGG
   5 PRODUCT SIZE: 194
     FORWARD PRIMER    1555   20  59.96  60.00  CCCTGGGACTAGGGGGTTAA
     REVERSE PRIMER    1729   20  60.04  55.00  CTAGCTCAGCTGCACCCTTT

For the record, this is on Ubuntu 14.04, with emboss 6.6.0 install via apt.

apt-cache show emboss
Package: emboss
Priority: optional
Section: universe/science
Installed-Size: 4112
Maintainer: Ubuntu Developers <ubuntu-devel-discuss@lists.ubuntu.com>
Original-Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Architecture: amd64
Version: 6.6.0-1
Depends: emboss-lib (= 6.6.0-1), libc6 (>= 2.14), libexpat1 (>= 2.0.1), libx11-6, zlib1g (>= 1:1.1.4), emboss-data (= 6.6.0-1)
Recommends: primer3, dialign
Suggests: emboss-doc, emboss-test, embassy, clustalw
Filename: pool/universe/e/emboss/emboss_6.6.0-1_amd64.deb
Size: 953186
MD5sum: 3f3ed81fd191d9c431d7636a558a9001
SHA1: 467970bc7328ba7de41e81f2d7bed083151da411
SHA256: 32cfbae45b21441114506d719c6627fc72060a67a5bdf74bcb49ce9cb46d5e12
Description-en: european molecular biology open software suite
 EMBOSS is a free Open Source software analysis package specially developed for
 the needs of the molecular biology (e.g. EMBnet) user community. The software
 automatically copes with data in a variety of formats and even allows
 transparent retrieval of sequence data from the web. Also, as extensive
 libraries are provided with the package, it is a platform to allow other
 scientists to develop and release software in true open source spirit. EMBOSS
 also integrates a range of currently available packages and tools for sequence
 analysis into a seamless whole. EMBOSS breaks the historical trend towards
 commercial software packages.
Description-md5: 4f3d6a457939538fb5f7639f0452d33e
Homepage: http://emboss.sourceforge.net
Bugs: https://bugs.launchpad.net/ubuntu/+filebug
Origin: Ubuntu

$ uname -a
Linux vagrant-ubuntu-trusty-64 3.13.0-45-generic #74-Ubuntu SMP Tue Jan 13 19:36:28 UTC 2015 x86_64 x86_64 x86_64 GNU/Linux

Log in to answer this question.