This is a test version of Biostars. For the public version, visit https://www.biostars.org.
start and stop position of mapping in Blast

I used makeblastdb to search many short fasta sequences in a known organism. I successfully completed this step and got the mappings. My question is

How can I get the start and stop coordinate?

for eg

Query  1        AATATAGGTGGTACCACGGAATATCCGTCCTATTTGTATATAGGATGGATAtttttattt  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1765181  AATATAGGTGGTACCACGGAATATCCGTCCTATTTGTATATAGGATGGATATTTTTATTT  1765122

Query  61       ttttAGGAGGTATAGCAAATGG  82
                ||||||||||||||||||||||
Sbjct  1765121  TTTTAGGAGGTATAGCAAATGG  1765100

How to get 1765100 and 1765181 from a text file with many mappings like this. I would also like to count the number of mappings or query sequences?

blast
• 7,211 views • link
updated by Ram Ram • written by navyeinstein1991 • navyeinstein1991

use tabular output option:

blastn -query some.fa -db some.fa  -outfmt 6
• 0 views • link
written by Zhidkov Zhidkov

Every bioinformatics journey begins with a BLAST parser :)

• 0 views • link
written by Neilfws Neilfws

1 answer 

blastn -query some.fa -db some.fa  -outfmt 6 | awk '{print $9 "\t" $10}'
• 0 views • link
updated by Ram Ram • written by navyeinstein1991 • navyeinstein1991

Have in mind that sometimes $9 is greater than $10.

Also, there is no point in your answer as you're blasting some.fa against some.fa.

• 0 views • link
updated by Ram Ram • written by PoGibas PoGibas

there are some cases when you run blast using query both as query and as subject, clustering groups of sequences for example.

• 0 views • link
written by Zhidkov Zhidkov

in case alignment of query is in opposite direction to subject, then column 9 will be greater than column 10

blastn -query query.fa -db subject.fa  -outfmt 6 | awk '{OFS="\t"; if ($9>$10) print $9,$10; else print $10,$9}'
• 0 views • link
updated by Ram Ram • written by Zhidkov Zhidkov

Log in to answer this question.

More posts like this