I tried to trim primers from my fastq.gz files with cutadapt, but It trims whole a lot than I intended. In same cases It trims whole genes. The command I used for trimming:
cutadapt -a file:reverse.fasta -G file:forward.fasta -o out_R1.fastq.gz -p out_R2.fastq.gz in_R1.fastq.gz in_R2.fastq.gz
reverse.fasta is for reverse primers and forward.fasta is for forward primers.
These how I prepared my fasta files: for reverse,
>r1
ACAGAGGCTTCTTTTCCTACCAG
>r2
GTTCAAGCTGCAGAACACCAG
>r3
GAATCTTGGGCCCTAAACGTG
for forward,
>r1
CTTCCCCATAGTAGGTGACCAG
>r2
AGACTCCCAATCCCCAGGTC
>r3
GGCCTTCTCTCTGCGTTTG
I don't why It trims unintended places maybe there is something wrong with my fasta file. If It possible to trim primers in cutadapt, I would like to hear your suggestions or If there is any other tool that I can use.
Any help is much appreciated.
Thanks in advance.
hi bayramliaziz , I changed the category of your post to 'question' in stead of tool as we keep the latter for (new) tool announcements.