What is the right illumina universal adapter sequence for trimming paired-end reads?

Question

[maria2019]

I have paired-end WES reads and FastQC report shows adapter content error “Illumina Universal adaptor”. I read the Adapter_list.txt in the fastQC folder which says that the Illumina universal adapter can be summarized in the 12 bp fragment of AGATCGGAAGAG.

My question is should I use this sequence (AGATCGGAAGAG) for both forward and reverse reads? or I should make a complementary sequence of CTCTTCCGATCT for the reverse read?

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

or

cutadapt -a AGATCGGAAGAG -A CTCTTCCGATCT -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

?

Answer 1

[lakhujanivijay]

The answer is

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

You can use the same sequence. I think you should also check the trimming report, read 1 and read 2 should have similar stats.

[maria2019]

Thank you for your answer. I have tried both ways and then I see a good fastQC result with either of them! That is why I am not sure if I should just keep the first one or dig into it and find out which one is better.

What would be the good comparison point to decide which one to use?

[lakhujanivijay]

can you post the fastqc images here?

[biomagician]

Does cutadapt remove the sequence you put in and its reverse complement (+ to the end of the read) from every string in the fastq file?

[MatthewP]

I think it too short to use only 12 nt sequence to trim adapter. fastp gives Illumina universal adapter for both reads, reads 1 is _AGATCGGAAGAGCACACGTCTGAACTCCAGTCA_ and reads 2 is _AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT_

[bjwiley23]

I tried running flexbar with the longer adapters and it didn't remove any of the adapters. fastqc shows same.