Augustus Genome annotation

Question

[Inquisitive8995]

Hi, I am trying to run Augustus. But I have the assembled bam file which I converted to fastq and then to fasta using seqtk. I would like to know if I need to run a genome assembly on the raw fastq files before running augustus or can I directly upload this converted fasta file to augustus ?

The converted fasta file looks like this :

12235R:20:CCMWNACXX:8:1213:16137:43151/1 TTCATGATGGTAGCTGAGTGAAGAATGAAGACGATAAAGCACATGGTGAGACTGGG 12235R:20:CCMWNACXX:8:1213:16137:43151/2 ATCGCATACATGGGTCGCCGCCAGTCCGGGGAGGGTCATGGACGGCGCGCTGGCAGCG 12235R:20:CCMWNACXX:8:2303:10136:6015/1 ACGCAGAAGGCCAGATGATGGGAGGGAGGCACCCGCTCGCGGATCAGCTCTGCAGCCTGA

Thanks.

[lieven.sterck]

what do you mean with

assembled bam file

?

[Inquisitive8995]

I mean, I have the bam which I obtained after alignment.

[lieven.sterck]

OK, then indeed my answer below holds true.

Answer 1

[lieven.sterck]

Yes, you will need to run an assembler first.

In practice it's not really necessary but if you want to make any sense out of it you'll need to assemble them first indeed. If your sequences are (too) short , which they will usually be if you input raw reads, there is very little change you will get full genes on them.

[Inquisitive8995]

Thanks for your reply.