Can't tell the file format

Question

[Gabe Anderson]

Hi,

Can anyone help with a description of this file format? Obviously, it is neither fasta not fastq. It contains human RNA sequences.

hsa-miR-3670    AGAGCUCACAGCUGUCCUUCUCUA    hsa-mir-3670-1    40
hsa-miR-548z    CAAAAACCGCAAUUACUUUUGCA    hsa-mir-548z    54
hsa-miR-28-5p    AAGGAGCUCACAGUCUAUUGAG    hsa-mir-28    14
hsa-miR-28-3p    CACUAGAUUGUGAGCUCCUGGA    hsa-mir-28    54
hsa-miR-3119    UGGCUUUUAACUUUGAUGGC    hsa-mir-3119-2    9
hsa-miR-4314    CUCUGGGAAAUGGGACAG    hsa-mir-4314    11
hsa-miR-4741    CGGGCUGUCCGGAGGGGUCGGCU    hsa-mir-4741    59

Also, is it possible to convert a fasta file to this format?

Thanks!

[Jean-Karim Heriche]

It looks just like a plain whitespace (tab ?)-delimited text file.

[Ram]

It's the pwt?dt format, of course!

[Gabe Anderson]

I'm sorry I didn't get the format you mentioned. which is it, pls?

[Ram]

I was making a joke by abbreviating Jean-Karim's response. Your data is white space separated, and unless you give us more details on the tool that output it, we cannot help you with it.

[Gabe Anderson]

I cant tell the tool that out put that data. I am trying to run miRExpress and one of their sample files come in that format. I tried both fa and fq and it returned a segmentation fault. So I am looking to convert my fa or fq file to this format to avoid the seg fault.

[Biomonika (Noolean)]

I believe that unless you provide as piece of that fasta file and desired output file for the same file, no one here can really help you.

[Biomonika (Noolean)]

Just tell us what you want to convert to what if that's what you need. This may not be any format in particular.

Answer 1

[ehscholl]

Did you ever find an answer to this?

To add to the original poster's question:

The software miRExpress requires a file for mature known miRNA sequences that is formatted like the above. The first three columns are pretty straight-forward, but it's not clear what the 4th column is supposed to be.