duplicates managment with the merged column

Question

[micro32uvas]

Hi everyone,

I need urgent help in terms of data duplication. given the data below, I want first sequence to be repeated twice. In short I want 2nd and 3rd column to merge along with the first column. It doesn't coincide. Do I need to do it manually all along?

Need help!

Regards,
Qurat

[micro32uvas]

bta-mir-225            bta-mir-225         ATCGGGTGCGTCAGTGAC
                       bta-mir-454         TGTCGTACGTACAGTAACGTAG
bta-mir-454            bta-mir-367         AAAGTACGATGACGTTAGAT
bta-mir-367

All I want is to duplicate 225's sequence in next row along.coinciding the merged matches. i.e. (see line-2 below)

bta-mir-225           bta-mir-225         ATCGGGTGCGTCAGTGAC
                      bta-mir-225         ATCGGGTGCGTCAGTGAC
bta-mir-454           bta-mir-454         TGTCGTACGTACAGTAACGTAG
bta-mir-367           bta-mir-367         AAAGTACGATGACGTTAGAT