Hi,
I have a list of mutations and their genomic positions.
for example:
chr1:1573209-1573209 T>A
and I have fasta sequences of the consensus sequence around the sites of these mutations.
for example:
>hg19_ct_UserTrack_3545_CDK11A range=chr1:1573157-1573247 5'pad=10 3'pad=10 strand=+ repeatMasking=lower
GAGGATGGTGTTGATCTCCCTCAGCGACGTGATCGGGAAGCCCTCCTTCT
CCTTCTCCATCTTCAGCCGCTTTAGAGCCACAATTTCATCT
Is there any tool that can insert the mutation into the fasta?
and more complicated - a tool that can combine several different mutations in the same fasta?
I wrote a perl script that creates a fasta for each mutation, but now I need to create all possible combinations of mutations (i.e. if there are 3 different mutations in a single fasta sequence, I need all the combinations: mut1 + mut2, mut2 + mut3, mut1 + mut2 + mut3), and I wonder if there is an existing tool that can do that.
Thanks in advance for any help