Question: No aligned reads after featurecounts. BAM files have >85% reads mapped
0
10 weeks ago
LAB_2019 • 0

Hello, new to RNA-seq here. I have mapped my fastq reads to a reference genome (transcript.fasta) with HISAT2. The BAM files look very good with >85% reads mapped. However, when I try to use featurecounts, both local and on Galaxy, the results always yield 0 mapped reads. From lurking around the web, it seems there may be a disconnect between my BAM file Headers and the .GFF file that I am using in feature counts.

Example line of .GFF
Seqname Source  Feature Start   End Score   Strand  Frame   Group

Niben101Ctg00054    maker   exon    167 487 .   +   .   ID=Niben101Ctg00054g00001.1:exon:001;Parent=Niben101Ctg00054g00001.1;Alias=snap_masked-Niben101Ctg00054-processed-gene-0.0-mRNA-1:exon:4812

Example line of .BAM
A00247:109:GW190602181st_novaxp:1:1402:19651:8030   419 Niben101Ctg00109Ctg001  108 3   141M    =   120 151 CTTCAGACATCTTGGCATGGCATTTGACATGTATCAATCGTTGACACCATAAACAATACCAAGTTGGAGATGCATCAAGGAAAGGAACACCACAAGGTTCATCACAGTAGAAACAAAAGGCAGACATCTCAGGATTCTCAT   FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF   AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YT:Z:UU NH:i:2 CC:Z:Niben101Scf04375Ctg112 CP:i:5129 HI:i:0

Here is a sample output summary:

Status  accepted_hits_Mock-1.bam
Assigned    0
Unassigned_Unmapped 0
Unassigned_MappingQuality   0
Unassigned_Chimera  7331650
Unassigned_FragmentLength   0
Unassigned_Duplicate    0
Unassigned_MultiMapping 10893853
Unassigned_Secondary    0
Unassigned_Nonjunction  0
Unassigned_NoFeatures   26615011
Unassigned_Overlapping_Length   0
Unassigned_Ambiguity    0

Is there any obvious discrepancy that could cause this? In featurecounts, I have used 'ID' as my gene identifier, not gene_id as it is not present in my .gff file. I'm hoping there is a simple error that is causing this complete failure.

Thanks!

ADD COMMENTlink 10 weeks ago LAB_2019 • 0 • updated 10 weeks ago lieven.sterck 5.1k
0

How to add images to a Biostars post

I added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink 10 weeks ago
WouterDeCoster
39k
0

That is indeed likely the most obvious issue.

From the example you provided I think the reference sequences IDs do not seem to correspond (naming schema-wise)

Niben101Ctg00054 <--->  Niben101Ctg00109Ctg001

can you double check if they are OK? Did the formatting of the index for the alignment went ok?

ADD REPLYlink 10 weeks ago
lieven.sterck
5.1k
0

The BAM files were generated using a "contigs" .fasta and a "transcripts" .fasta. The transcript format wasx as such:

Niben101_annotation.transcripts.fasta
>Niben101Scf03546g00006.1
TTTTTAAATATTAAATTCATAAAATTTAGACCTGG

Is there a way to edit the BAM or .GFF files to create uniformity between these files? All files were downloaded from a single source ftp://ftp.solgenomics.net/genomes/Nicotiana_benthamiana/ It seems odd that they would not work together for this analysis.

ADD REPLYlink 10 weeks ago
LAB_2019
• 0
0

hard to tell without having our hands on your data.

why are you using a (genome?) contig and a transcript file as reference? If you merged 2 files into one you have to make sure the IDs are unique over both files.

can you check if the transcript/contig ID I posted before does exist in your contig/transcript file? eg by doing grep Niben101Ctg00109Ctg001 <contig/transcript file>

ADD REPLYlink 10 weeks ago
lieven.sterck
5.1k
0

Thanks for the advice. I am going to re-align one test sample using only 1 .fa file. I will double check the Genome.fa and transcripts.fa to make sure they have the same ID's as my .GFF file. I am mainly trying to differential gene expression analysis. Would you recommend using only the transcripts.fa? Or should I only use the contigs.fa?

ADD REPLYlink 10 weeks ago
LAB_2019
• 0
0

what is the difference between the contigs and the transcript file?

ADD REPLYlink 10 weeks ago
lieven.sterck
5.1k
0

I simplified this. I re-ran HISAT2 with my paired-end fastq files and only the transcripts.fa file as a reference. here is the format of the transcripts.fa

>Niben101Scf03546g00006.1
TTTTTAAATATTAAATTCATAAAATTTAGA

This produced the .BAM file. Here is a sample for idxStats (had ~65% mapped reads)

1   2   3   4
Niben101Scf03546g00006.1    2081    98  9
Niben101Scf03546g00007.1    2438    1331    18

I then tried to use featureCounts on galaxy with the BAM file shown below:

A00247:109:GW190602181st_novaxp:1:1501:15817:30107  83  Niben101Scf03546g00007.1    452 60  141M    =   404 -189    AAGAGGAAGTGGTTGTGGAGACATCATTTGCACCTAAGAGTTTTCCGAGCAAAGTGGGAGGGGGGATTAATGGAGAGCCACCAGATGATTCATCCCCTAATGCTTTGGAGAAATGGGTTGTAAAGGTTGAGCAGTCTATAA   FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFF   AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:141 YS:i:0 YT:Z:CP NH:i:1
A00247:109:GW190602181st_novaxp:1:1235:3531:33974   163 Niben101Scf03546g00007.1    453 60  140M    =   632 320 AGAGGAAGTGGTTGTGGAGACATCATTTGCACCTAAGAGTTTTCCGAGCAAAGTGGGAGGGGGGATTAATGGAGAGCCACCAGATGATTCATCCCCTAATGCTTTGGAGAAATGGGTTGTAAAGGTTGAGCAGTCTATAA    FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFF:FFFFF,FFFFFFFFFFFFFFFF:FFFFFFF::FFFF:FFFFFFFFFFFFFFFFFFF:F,FFFFF:FFFFFFFFFFFFFFFFF    AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:140 YS:i:0 YT:Z:CP NH:i:1

I used the following .GFF file

Niben101Ctg01237    repeatmasker    match   1   526 1713    +   .   ID=Niben101Ctg01237:hit:145937:1.3.0.0;Name=species:Copia-3_SL-I|genus:LTR%2FCopia;Target=species:Copia-3_SL-I|genus:LTR%2FCopia 300 825 +
Niben101Ctg01237    repeatmasker    match_part  1   526 1713    +   .   ID=Niben101Ctg01237:hsp:274063:1.3.0.0;Parent=Niben101Ctg01237:hit:145937:1.3.0.0;Target=species:Copia-3_SL-I|genus:LTR%252FCopia 300 825 +

I am so confused by the nomenclature. there are no chromosomes, sometimes there are contigs (Ctg) , sometimes there are what I assume scaffolds (Scf).

ADD REPLYlink 10 weeks ago
LAB_2019
• 0

Login before adding your answer.

Powered by the version 1.5