Hi All, I got stuck with the results after the mirdeep2 analysis. I have an independent microRNA analysis for 3 biological replicates in two treatments. After combining all data I often get results: 1. the same micro sequence, and pre-miRNA coordinates differ by one or several nucleotides 2. the same micro-sequence and the completely different pre-miRNA location How to deal with such cases during DE analysis? Which cases can I combine?
consensus mature sequence consensus star sequence precursor coordinate
___________________________________________________________________________________
aaaaauacgacuugcaacuucugc agaaguugcuagucguauuuu chr7:10801998..10802090:+
aaaaauacgacuugcaacuucugc agaaguugcuagucguauuuuu chr7:10801998..10802091:+
aaaaauacgacuugcaacuucugc agaaguugcuagucguauuuuug chr7:10801998..10802092:+
aaaaauacgacuugcaacuucugc aguugcuagucguauuuuugu chr7:10801998..10802093:+
aaaaauacgacuugcaacuucugc aguugcuagucguauuuuuguaa chr7:10801998..10802095:+
aaaaauacgacuugcaacuucugc aguugcuagucguauuuuuguaaa chr7:10801998..10802096:+
Best regards,* Magda